miRNAs | Sequence | Targets | Inhibition | Probable Function | miRNAsstart | miRNAs end | Targets start | Targets end | Target aligned fragment |
---|---|---|---|---|---|---|---|---|---|
miRNA167 | TGAAGCTGCCAGCATGATCTC CUCUAGUACGACCGUCGAAGU | PPP3R2 | Cleavage | Inhibit MAPK and GPCR pathway | 1 | 21 | 1205 | 1225 | UAUGUCAUGUUGGUAGCUUUA |
miRNA1525 | TGAGTTAATTAAGTTTTTATG GUAUUUUUGAAUUAAUUGAGU | TNFSF15 | Cleavage | Activate both the NF-κB and MAPK signalling pathways Prevent apoptosis Inhibits cell proliferation and angiogenesis | 1 | 21 | 4011 | 4031 | UAUAAAAGUUUAACUAACUCA |
PCGF5 | Cleavage | Â | 1 | 20 | 1953 | 1972 | AUGGAAUUUUAAUUAACUCA | ||
RHD | Cleavage | Â | 1 | 21 | 689 | 709 | CAUAGAAACUUAAUUAGAUUA | ||
YIPF6 | Translation | Inhibits vesicle formation, trafficking, and budding | 1 | 21 | 3017 | 3037 | UAUAAAAACUCAAUUGAUUCC | ||
SETD7 | Cleavage | Inhibit expression of collagenase and insulin gene Stabilizes p53/TP53 and increasing p53/TP53-mediated transcriptional activation | 1 | 21 | 3614 | 3634 | UAUAAAAAUUUAAAUCACUCA | ||
DCC | Cleavage | Inhibits apoptosis Reduces tumour suppressor activity | 1 | 21 | 2914 | 2934 | UAUAAAAAUUUAGAUAGUUCA | ||
ATRN | Cleavage | Prevent obesity Reduces inflammation | 1 | 20 | 656 | 676 | UAUAGUAACUUGAUUAAUUUA | ||
SLC25A42 | Cleavage | Alters mitochondrial transport of proteins | 1 | 20 | 1992 | 2011 | AUAAAAACUUAAAUGACUUC | ||
CLEC2D | Cleavage | Prevent Osteoporosis type of condition | 1 | 20 | 313 | 332 | AAAGAGAUUUAAUUGACUCA | ||
SRXN1 | Translation | Reduces resistance to oxidative stress Increases activity of anti-oxidative stress enzymes | 1 | 20 | 2070 | 2089 | AUAAAAGUUUAUUUAAUUUA | ||
ALPK1 | Cleavage | Influence neuronal coordination | 1 | 20 | 769 | 788 | AAAGAGGUUUAAUUAACUCA | ||
ZFP36L1 | Translation | Alters effect of growth factors and other cytokines | 1 | 21 | 1151 | 1171 | UAAAAAAGCUUAUUUAACUUA | ||
HDX | Translation | Alter activity of several transcription factor | 1 | 20 | 458 | 477 | UUAAAAAAUUAUUUAACUCA | ||
GAB1 | Cleavage | Prevent tubulogenesis, cellular growth response, growth transformation and apoptosis | 1 | 20 | 1945 | 1964 | AUAAAUACAUGAUUAAUUCA | ||
PNPO | Cleavage | Prevent epileptic changes | 1 | 20 | 688 | 707 | AUUACAACUUAACUAACUCA | ||
miRNA1568 | CGGCGTCGTCTTCGCTCCCGA AGCCCUCGCUUCUGCUGCGGC | CD99L2 | Cleavage | Prevent leucocyte infiltration and subsequent immune response | 1 | 21 | 304 | 324 | GCGGGGGCCAAGAUGAUGCUG |
miRNA 129 | TCCGGAGGGATCCCTTCCTTG GUUCCUUCCCUAGGGAGGCCU | PGM3 | Cleavage | Prevents glycogen storage and utilization Prevent resistance to diabetic nephropathy and neuropathy | 1 | 21 | 1901 | 1921 | AAAGGAAGGGAUCCCUCAGGA |
NAPB | Translation | Prevent amyotrophy and hereditary neuralgic | 1 | 21 | 600 | 620 | UGAGGAAGGGAGCUUUCUGGA | ||
DLG2 | Cleavage | Neurological role | 1 | 21 | 483 | 503 | AAAGAAAGGAAUCCCUUUGGA | ||
miRNA 756 | AGATCATCTGGCAGTTTCAAT UAACUUUGACGGUCUACUAGA | CYB5B | Cleavage | Prevent accumulation of oxygenases | 1 | 21 | 639 | 659 | CUUAAAACUGCCAAAUGAUUU |
ETV5 | Cleavage | Prevent neurofibromatosis, type 2 and other neurological conditions | 1 | 21 | 2206 | 2226 | CUUGAACCUGCCAGCUGAUUU | ||
GREM2 | Cleavage | Prevent metastasis and cell migration differentiation | 1 | 21 | 3138 | 3159 | UUUGAAAUUGGCCAGAUGAUUU |