Skip to main content

Table 1 Nucleotide sequences of LAMP primers (AF and RE) designed in this study

From: Rapid diagnosis of Toxoplasma gondii using loop-mediated isothermal amplification assay in camels and small ruminants

Primer Gene Sequence (5′–3′)
AF-F3 AF 529-bp DNA repeat element (AF) GTTGGGAAGCGACGAGAG
AF-B3 ACAGTGCATCTGGATTCCTC
AF-BIP CCGGTGTCTCTTTTTCCACCCTTCGGAGAGGGAGAAGATGTT
AF-FIP CCTCGTGGTGATGGCGGAGATCCCTTCGTCCAAGCCTC
RE-F3 RE gene GTTGGGAAGCGACGAGAG
RE-R3 CAGTGCATCTGGATTCCT
RE-BIP CTCGTGGTGATGGCGGAGATTTTCGTCCAAGCCTCCGACTCTG
RE-FIP CGGTGTCTCTTTTTCCACCCTTTTTTCGGAGAGGGAGAAGATGTTT