Molecular characterization of the camel nasal botfly, Cephalopina titillator (Diptera: Oestridae)

Beni-Suef University Journal of Basic and Applied Sciences

Table 3 The primer sequences of COI and 28S rRNA markers in both the forward and reverse directions

Primer	Direction	Primer sequence	Expected gene fragment length	References
COI	“Forward” COI/F	5’- TCTCTACCAGTTTTAGCAGGAG -3’	916 bp	Custom-designed in this study
COI	“Reverse” COI/R	5’- GTTCAGCAGGTGGTGTATTT -3’	916 bp	Custom-designed in this study
28S rRNA	D1 “Forward”	5’- CCCCCTGAATTTAAGCATAT -3’	830 bp	[18, 21]
28S rRNA	D2 “Reverse”	5’-GTTAGACTCCTTGGTCCGTG -3’	830 bp	[18, 21]