2.1 Topography of studied area, sample collection and ethical compliance
The studied area comes under semi arid zone of northern India and comprised of Mathura, Uttar Pradesh and borders of Rajasthan. The area is located at 27.49° N latitude and 77.67° E longitude. The studied area is considered endemic for tropical theileriosis [3, 10] as the semiarid weather favours the propagation of tick vectors [5]. Unrestricted movement of animals infested with ticks, across the open borders, further adds to spread of the disease.
Blood samples from 100 randomly selected buffaloes were collected in sterilized vacutainers. All the screened animals were adults (3–5 years of age) and apparently healthy without any history of any previous disease exposer in recent past (up to last 6 months). Blood was stored at − 20 °C till DNA was isolated. Alongside, thin blood smears were examined microscopically following Giemsa staining, for presence of intraerythrocytic piroplasm or Koch blue bodies (Fig. 1a, b). Collection of blood was done in accordance with the laid guidelines of Institutional Animal Ethical Committee, and the due permission was accorded via voucher number IAEC/17/23.
2.2 DNA extraction, comparative LAMP assay vis-à-vis PCR
DNA was extracted using commercial DNA extraction kit (Promega©, USA) following the manufacturer’s protocol. Four primers (F3, B3, FIP, BIP) were custom synthesized from Imperial Life Sciences©, Gurugram, India [11]. The primers were firstly checked on Primer Explorer V4 program before ordering. The primer sequence consisted of F3: TGCACACAGTCATCTCAA; B3: GTGTGAGCCAAGACATCC; FIP: TTCACAAATCCAAATGGAAAGCTCTGAATTCGTCTACATTTTGTGGAATTGGT and BIP: ACAAGAGTTCAAGGACTAGAACCTGAATTCTAAATCCGAGTTACAAGGACC.
LAMP reaction was set up in a final volume of 25 µl and the reaction mixture comprised of 2.5 µl of 10X LAMP buffer (Imperial Life Sciences©), 1 µl of dNTP (0.4 mM), 0.5 µl of F3 and B3 primers (each 20 pmol), 2 µl of FIP and BIP primers (each 30 mol) 2 µl of MgSO4 (2 mM; Imperial Life Sciences©), 2 µl of betaine (0.4 M; Sigma Aldrich©) and 2 µl of DNA template. The volume was made 24 µl by adding nuclease-free water. This mixture was heated at 95 °C for 5 min followed by chilling on ice. Subsequently, 1 µl (8U) of Bst polymerase (Imperial Life Sciences©) was added to it, and the tube containing the reaction mixture was kept at 60 °C for 60 min. Finally, the reaction was terminated by heating the reaction mixture at 80 °C for 2 min. For comparing LAMP, PCR was also done on all the samples targeting Theileria annulata merozoite surface protein (TAMS 1) gene following the protocol of Paliwal et al.[12]. Initially, LAMP and PCR assays were laboratory standardized on known positive DNA of T. annulata (confirmed by sequencing, accession number: MH277611). Once standardized, the protocols were performed on individual blood sample collected from buffaloes. The positive amplification was seen at 785 bp specific for primers described previously. Genomic DNA from a known negative buffalo calf and nuclease-free water served as negative and no template controls, while the confirmed T. annulata DNA served as positive control.
2.3 Visualization of LAMP and evaluation of LAMP vis-à-vis PCR and blood microscopy
The LAMP mixture tubes were removed after termination of reaction, and 1 µl of fluorescent intercalating SYBR green dye (Invitrogen©) was added for visualization of DNA accumulation in reaction tubes by visual fluorescence. The positive samples were visualized by change in colour of reaction mixture upon addition of dye. Further, the LAMP as well as PCR products were run on 1.5% agarose gel incorporated with ethidium bromide following electrophoresis.
The specificity of LAMP primers was checked using the known DNA of Trypanosoma evansi, Babaesia bigemin, Theileria equi and Ehrlichia canis. MedCalc software was used for calculating relative sensitivity and specificity of LAMP in comparison with PCR and blood microscopy. Finally, kappa values were calculated using GraphPad software.
