Skip to main content
Beni-Suef University Journal of Basic and Applied Sciences
Download PDF

Role of nuclear factor kappa B, interleukin-19, interleukin-34, and interleukin-37 expression in diabetic nephropathy

Beni-Suef University Journal of Basic and Applied Sciences volume 11, Article number: 119 (2022) Cite this article

Abstract

Background

The long-term effects of diabetes mellitus (DM) can impair several organs, including the kidney, resulting in serious health problems. Diabetic nephropathy (DN), a primary contributor in end-stage renal failure worldwide, affects 20–30% of patients with type 2 DM (T2DM). This study was designed to assess the contribution of nuclear factor kappa B (NF-κB) and interleukin (IL)-6, IL-19, IL-34, and IL-37 in the development of DN.

Methods

The study included 160 participants, of which 130 were allocated into the patients with diabetes group, patients with chronic kidney disease (CKD), and patients with diabetic chronic kidney disease (DCKD), and 30 were healthy controls.

Results

The obtained data revealed a significant (p < 0.05) increase in IL-19, IL-34, and NF-κB mRNA expression and serum IL-6 levels in patient groups (CKD and DCKD) compared with the healthy control group, whereas IL-19, IL-34, and NF-κB mRNA expression showed a marked elevation in the DCKD group when compared with patients with CKD. Conversely, IL-37 mRNA expression and serum superoxide dismutase (SOD) activity were significantly (p < 0.05) decreased in both groups relative to the healthy controls, whereas the decrease was markedly higher in the DCKD group when compared with the CKD group.

Conclusion

The obtained results could indicate the potential implication of NF-κB, IL-19, IL-34, and IL-6 levels, along with the decrease in IL-37 expression and serum SOD activity, in the pathophysiology of kidney disease in diabetes. Moreover, designing drugs targeting these cytokines and/or their signal pathways may prevent or alleviate the progression of kidney disease.

1 Background

Diabetes mellitus (DM) can impact several organ systems, resulting in critical problems [1]. Diabetic nephropathy (DN) is among the main complications of diabetes mellitus and has been a major factor in renal failure [2]. DN or diabetic renal diseases are disorders characterized by persistent albuminuria and a progressive decline in renal function, arterial hypertension, and a reduction in glomerular filtration [3]. Accordingly, DN is one of the more common types of diabetic microangiopathy. DN pathogenesis has been linked to inflammatory mediators, such as adhesion molecules, nuclear factors, cytokines, growth factors, and immune cells [4].

A family of DNA-binding proteins called nuclear factor kappa B (NF-κB) is crucial for the transcription of more than 400 genes, including cytokines, chemokines, and their modulators, immune and non-immune receptors, as well as different enzymes; all these molecules control several biological processes [5]. NF-κB has vital role in controlling the immune response; thus, angiotensin II-induced production of pro-inflammatory molecules in renal damage is important [6]. The antioxidant defense system may have a key role in diabetic vascular injury. Superoxide dismutase (SOD) is the principal antioxidant enzyme for superoxide elimination, which can convert superoxide to hydrogen peroxide (H2O2) and molecular oxygen [7]. In addition, SOD gene polymorphism is involved in human DN risk and it might be used in the prediction of kidney-related complications in diabetic patients as an independent genetic factor [8].

Elevated interleukin-6 (IL-6) expression impairs renal function by worsening kidney cell infiltration, and DN has higher IL-6 levels [9]. IL-19 is a newly discovered cytokine of the IL-10 family. In diabetic patients with microalbuminuria, IL-19 levels may rise as a result of preexisting atherosclerosis [10]. In addition, IL-34 is a newly discovered cytokine whose increased levels are independently linked with kidney disease [11]. Moreover, IL-37, a member of the IL-1 family, is significantly reduced, and the overexpression of IL-37 reduces the development of diabetes [12] and may prevent renal damage after renal ischemia and transplantation [13].

However, the involvement of cytokine-induced inflammatory mechanisms in DN requires further investigation. Hence, the study aims to explore the implications of an inducible transcription factor, NF-κB, and pro-inflammatory cytokines, IL-6, IL-19, and IL-34, as well as the anti-inflammatory cytokine, IL-37, in DN.

2 Patients and methods

2.1 Patients

The study population comprised diabetic patients (diagnosed according to the 1999 World Health Organization criteria) or those without renal impairment or hemodialysis. Overall, 130 patients from the Kidney Hospital, Beni-Suef, Egypt, were enrolled in the current study. In addition, healthy control participants enrolled in the study were free from type 1 diabetes mellitus or T2DM and had no first-degree relatives to diabetes and kidney dysfunction, while the enrolled diabetic chronic kidney disease (DCKD) patients have had diabetes for several years prior to developing nephropathy, whereas chronic kidney disease (CKD) patients are non-diabetic subjects who have had nephropathy for several years. Diabetes was diagnosed according to the World Health Organization’s 1999 criteria. For all enrolled subjects (healthy controls and patients), the key exclusion criteria included the presence of thyroid diseases, autoimmune disorders, infectious diseases, asthma, eczema, allergies, respiratory disorders, chronic liver, and cardiac diseases, and malignancies. Before participation in the experiment, written consent was obtained from all patients. The research protocol was approved by the Kidney Hospital, Beni-Suef, Egypt, ethical committee in compliance with the Declaration of Helsinki and the recommendations for good clinical practice (BSU/2018/7).

2.2 Experimental design

The study population included 160 participants of both sexes, allocated into the following four groups according to biochemical biomarkers:

Group 1: Healthy control group (n = 30).

Group 2: Diabetes group (glycosylated hemoglobin (HbA1c) > 6.4%, serum creatinine < 1.5 mg/dl, and/or glomerular filtration rate (GFR) ≥ 90 mL/min/1.73 m2] (n = 30).

Group 3: CKD group (HbA1c < 6%, serum creatinine > 2 mg/dl, and/or GFR < 90 mL/min/1.73 m2) (n = 50).

Group 4: DCKD group (HbA1c > 6.4%, serum creatinine > 2 mg/dl, and/or GFR < 90 mL/min/1.73 m2) (n = 50).

Blood samples were obtained from subjects who had fasted overnight and incubated at room temperature for 30 min and then centrifuged. The sera were immediately separated and stored at − 20 °C for biochemical analysis. The second component of the blood sample was placed in a sodium fluoride tube to determine the plasma glucose level, and the third part of the blood sample was added to ethylenediaminetetraacetic acid to measure HbA1c% and mRNA expression.

2.3 Laboratory assays

Fasting blood glucose, serum creatinine, urea, and uric acid levels were assayed using kits obtained from Spinreact (Spain). The percentage of glycosylated hemoglobin in the blood was tested using reagent kits from Stanbio (USA). The homeostasis model assessment for insulin resistance (HOMA-IR), homeostasis model assessment for insulin sensitivity (HOMA-IS), and homeostasis model assessment for beta-cell function (HOMA-β) were measured according to Wallace et al. [14]. The MDRD equation was used to determine the GFR [15]. Serum insulin, SOD, and IL-6 levels were measured using a standard sandwich enzyme-linked immune-sorbent assay kit purchased from MyBioSource (USA) according to the manufacturer’s instructions.

2.4 RNA isolation and qRT-PCR

Total RNA was isolated from the blood samples using a Qiagen extraction kit purchased from Qiagen (Germany). cDNA synthesis was performed using High-Capacity cDNA Reverse Transcription Kits (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. RT-PCR was conducted on a 20 μL system comprising 10 μL 1 × SsoFast EvaGreen Supermix (Bio-Rad, Hercules, CA, USA), 2-μL cDNA, 6 μL of RNase/DNase-free water, and 500 nM of the following primer pair sequences: NF-κB: F: 5′TACTCTGGCGCAGAAATTAGGTC3′ and R: 5′CTGTCTCGGAGCTCGTCTATTTG-3′; IL-19: F: 5′-CGAGCTCTCCCAGGGATT-3′ and R: 5′-CAGAGTCATCCATGACAACTATGAT-3′; IL-34: F: 5′-GCCACCCATCCTGGAAGTA-3′ and R: 5′-GACAACACGGATTCCACCTT-3′; IL-37: F: 5′CGGGATCCATGGTTCACACAAGTCCA3′ and R: 5′CCCAAGCTTCTAATCGCTGACCTACT3′; and β-actin: F: 5′-CTGTCTGGCGGCACCACCAT-3′ and R: 5′-GCAACTAAGTCATAGTCCGC-3.′ The conditions of the thermal cycler were as follows: 3 min at 95 °C, followed by 40 cycles of 15 s at 95 °C, 30 s at 55 °C, and 30 s at 72 °C. A melting curve was used to conduct a 60 °C–95 °C ramp for each reaction. The threshold time at which the fluorescent signal surpassed an arbitrarily determined threshold near the midpoint of the log-linear amplification phase was calculated for each process, as was the relative quantity of mRNA. The amplification data were analyzed using the manufacturer’s program, and the results were normalized to β-actin.

2.5 Statistical analysis

The results were analyzed using the Statistical Package for the Social Sciences (SPSS) for Windows (version 22.0, Chicago, IL, USA). A one-way analysis of variance was performed to compare the data across the different groups, followed by Duncan’s test to assess the significant differences between the groups. A simple linear correlation study was conducted using Pearson’s method to estimate the dependency degree between the variables. A p value < 0.05 was considered statistically significant.

3 Results

The demographics of the study groups are shown in Table 1. Group 1 included 30 healthy individuals (13 males and 17 females), aged 43.10 ± 12.11 years, who served as healthy controls. Group 2 included 30 subjects with diabetes (15 males and 15 females), aged 44.67 ± 13.72 years. Group 3 had 50 patients with CKD (27 males and 23 females), aged 49.54 ± 14.38 years. Group 4 included 50 patients with DCKD (30 males and 20 females), aged 56.96 ± 12.92 years. Body mass index (BMI) values exhibited a marked elevation in both groups with diabetes compared with the healthy control group (Table 1).

Table 1 Demographic and biochemical characteristics of the healthy control group and patient groups
Full size table

Regarding blood pressure (systolic and diastolic blood pressure), the results showed a significant (p < 0.05) elevation in all patients with kidney disease when compared to healthy controls (Table 1). The fasting glucose level and HbA1c% were markedly (p < 0.05) increased in diabetic and DCKD groups compared to the healthy controls. In addition, HOMA-IR revealed a significant increase in the groups with diabetes and DCKD, while HOMA-IS and HOMA-β were significantly decreased in the groups with diabetes and DCKD compared with the healthy control group (Table 1). Moreover, the serum levels of urea, creatinine, and uric acid were significantly increased in both groups with kidney disease (CKD and DCKD). However, creatinine levels in DCKD group showed a marked increase compared to the CKD group, whereas GFR levels were noticeably decreased in both groups (CKD and DCKD) compared with the healthy control group, with a noticeable decrease in DCKD as compared with the DCKD group (Fig. 1).

Fig. 1
figure 1

The levels of A creatinine, B urea, C uric acid, and D eGFR in healthy control, diabetic, chronic kidney dysfunction (CKD), and diabetic chronic kidney dysfunction (DCKD) groups. Data are represented as mean ± SD. Different letters indicate significant differences (p < 0.05). H.: Healthy, and GFR: estimated glomerular filtration rate

Full size image

The obtained data also revealed a marked increase in NF-κB, IL-19, and IL-34 mRNA expression and IL-6 production levels in the groups with diabetes, CKD, and DCKD compared with the healthy control group, whereas NF-κB, IL-19, and IL-34 mRNA expression showed a significant elevation in the DCKD group when compared with CKD group. Conversely, IL-37 mRNA expression and serum SOD activity levels revealed a noticeable (p < 0.05) decrease in both the CKD and DCKD groups relative to the healthy controls. Notably, the results of the DCKD group revealed a noticeable decrease compared to the CKD group (Figs. 2, 3).

Fig. 2
figure 2

The levels of A NF-κB mRNA expression, B SOD activity in healthy control, diabetic, chronic kidney dysfunction (CKD), and diabetic chronic kidney dysfunction (DCKD) groups. Data are represented as mean ± SD. Different letters indicate significant differences (p < 0.05). H.: Healthy, SOD: superoxide dismutase activity, NF-κB: nuclear factor kappa B

Full size image
Fig. 3
figure 3

The levels of A IL-6, B IL-19 expression, C IL-34 expression, D IL-37 expression in healthy control, chronic kidney dysfunction (CKD), and diabetic chronic kidney dysfunction (DCKD) groups. Data are represented as mean ± SD. Different letters indicate significant differences (p < 0.05). H.: Healthy, IL-6: interleukin-6, IL-19: interleukin-19, IL-34: interleukin-34, IL-37: interleukin-37

Full size image

Regarding correlation analysis, BMI (obesity marker) exerted a significant correlation with IL-37 (r =  − 0.256; p = 0.005), IL-34 (r = 0.209; p = 0.008), IL-19 (r = 0.163; p = 0.039), SOD (r =  − 0.255; p = 0.001), HOMA-IS (r =  − 0.378; p = 0.000), and HOMA-IR (r = 0.468; p = 0.000) (Table 2). HbA1c% also revealed a significant correlation with IL-37 (r =  − 0.419; p = 0.000), IL-34 (r = 0.393; p = 0.000), IL-19 (r = 0.290; p = 0.000), IL-6 (r = 0.246; p = 0.002), NF-κB (r =  − 0.224; p = 0.004), SOD (r =  − 0.406; p = 0.000), HOMA-IS (r =  − 0.628; p = 0.000), and HOMA-IR (r = 0.676; p = 0.000). Moreover, creatinine exhibited a significant correlation with IL-37 (r =  − 0.655; p = 0.000), IL-34 (r = 0.652; p = 0.000), IL-19 (r = 0.508; p = 0.000), IL-6 (r = 0.523; p = 0.000), NF-κB (r =  − 0.430; p = 0.000), SOD (r =  − 0.578; p = 0.000), HOMA-IS (r =  − 0.260; p = 0.001), and HOMA-IR (r = 0.247; p = 0.002). Moreover, GFR showed a significant correlation with IL-37 (r = 0.703; p = 0.000), IL-34 (r =  − 0.665; p = 0.000), IL-19 (r =  − 0.700; p = 0.000), IL-6 (r =  − 0.669; p = 0.000), NF-κB (r =  − 0.666; p = 0.000), SOD (r = 0.695; p = 0.000), and HOMA-IS (r = 0.164; p = 0.039) (Table 2).

Table 2 Correlation analysis between interleukins, SOD, NF-κB, insulin resistance, BMI, and kidney and glucose profiles
Full size table

4 Discussion

The prevalence of CKD has increased in recent decades, along with an increase in diabetes and hypertension, the two leading causes of CKD [16]. Herein, we investigated the contribution of NF-κB and IL-6, IL-19, IL-34, and IL-37 in the pathogenicity of DN. Our data revealed that HbA1c% increased in all groups with diabetes compared with healthy controls. In addition, there was a marked increase in the serum levels of urea, uric acid, and creatinine, as well as a decrease in GFR levels, in both groups with kidney dysfunction. The increase in creatinine levels and the decrease in GFR levels were markedly observed in the DCKD group. Inflammation, which is closely associated with renal illness, is described as a complex network of interactions between renal parenchymal cells and local immune cells such as macrophages and dendritic cells, as well as recruitment of circulating monocytes, lymphocytes, and neutrophils [17].

Hyperglycemia is thought to reflect a state of elevated oxidative stress due to excessive production of ROS and a deficient antioxidant response [18]. Our data showed that serum SOD activity levels were markedly decreased in patient groups compared with healthy controls. Enhanced ROS production in the glomerular microcirculation lowers nitric oxide bioavailability, leading to mesangial contraction dysfunction and arteriolar tone, as well as persistent oxidative stress, which causes endothelial disorder, leukocyte adhesion, and apoptosis of glomerular cells [19]. In agreement with our findings, Liu et al. [20] demonstrated upregulation of renal SOD activity in diabetic mice. The antioxidant enzyme SOD is an important part of the cell’s defense against increased oxidative stress. It is therefore speculated that the decreased levels of SOD in patients with diabetes could lead to cytotoxic levels of superoxide overproduction, which may result in diabetic renal tissue damage [21]. However, oxidative damage, inflammation, and cell death caused by hyperglycemia could be alleviated by SOD. Consequently, the reduction in serum SOD levels may contribute to the onset of DN.

The stimulation of the transcription factor NF-κB by oxidative stress caused by hyperglycemia may increase the levels of pro-inflammatory cytokines, which could promote DN [5, 6]. The current data revealed a noticeable increase in NF-κB expression levels in the groups with diabetes, CKD, and DCKD compared to the healthy control group. Moreover, NF-κB mRNA expression showed a positive correlation with HbA1c and creatinine and a negative correlation with GFR levels. Hyperglycemia leads to the production of ROS in mesangial cells, which upregulates NF-κB. Interestingly, NF-κB inhibitors protect against kidney injury and may be useful in inflammatory diseases [22]. Notably, inhibiting the RAS and/or the NF-κB system may become an effective therapeutic asset to detain renal injury [23]. Angiotensin II elevation, which is directly connected to hypertension, is a stimulus for NF-κB activation and the production of inflammatory responses. Additionally, NF-κB has been linked to the pathophysiology of kidney injury caused by hypertension [24]. Importantly, the stimulation of NF-κB signaling regulates a variety of pro-inflammatory genes, including those that encode chemokines and cytokines like IL-6 [25].

IL-6 is a pro-inflammatory cytokine that strongly promotes the progression of insulin resistance and the pathophysiology of T2DM through the regulation of differentiation, proliferation, and cell death [26]. In our study, serum IL-6 levels significantly increased in the groups with diabetes, DCKD, and CKD. In addition, IL-6 production showed a positive correlation with HbA1c and creatinine but a negative correlation with GFR levels. According to our findings, pro-inflammatory cytokines, such as IL-6, IL-1b, and TNF-α, have been linked with the severity of CKD. These are produced by adipose tissue (along with lymphocytes), which becomes dysfunctional during CKD [27]. Notably, elevated IL-6 levels are not only a consequence of renal disease, but more importantly, it also acts as a trigger for the progression of renal disease and its related complications [28]; these results indicate that IL-6 contributes to the higher prevalence of CKD. Interestingly, it can be concluded that IL-6 impacts renal resident and infiltrating cells, affecting vascular permeability and promoting mesangial cell proliferation, glomerular basement membrane thickening, extracellular matrix synthesis, and neutrophil infiltration into the tubulointerstitium, resulting in DN progression [4]. As a result, increased IL-6 levels in human sera are both an early and strong indicator of DN initiation.

It is worth mentioning that IL-6 trans-signaling induced by Ang II might activate STAT3 in podocytes, which would impact podocyte differentiation, cell cycle, and other physiopathologic processes [28]. Importantly, increased IL-6 production by podocytes activated the JAK2/STAT3 pathway via enhanced phospho-JAK2 binding to gp130 and STAT3 phosphorylation. Likewise, hyperglycemia enhanced IL-6 production and signal transduction in podocytes, which was inhibited by an IL-6-neutralizing antibody or IL-6 siRNA. Therefore, the inhibition of IL-6 and its downstream mediators, including IL-6R and gp130, may reduce the onset of DN [29].

IL-19, a pro-inflammatory cytokine, promotes the T-helper 2 response [10]. Indeed, Cuneo et al. revealed that IL-19 is activated by pro-inflammatory cytokines and is expressed in damaged vascular smooth muscle cells [30]. IL-19 may be implicated in the development of vascular disease in diabetes. Serum IL-19 concentrations were positively correlated with Ang II and showed a significant association with insulin resistance and HbA1c%, suggesting that IL-19 is strongly linked with impaired glucose metabolism and vascular disorders in patients with T2DM [31]. Regarding IL-19 expression, increased IL-19 expression in the groups with diabetes and both CKD and DCKD groups was observed. Furthermore, IL-19 mRNA expression showed a positive correlation with BMI, HbA1c, and creatinine but a negative correlation with GFR levels. Similarly, patients with DN had considerably greater serum levels of IL-19 compared with the controls [32] and revealed a positive correlation with HbA1c%, urea, creatinine, and CRP. Li et al. [10] proposed that chronic hyperglycemia may enhance the expression of IL-19 by activating endothelial cells, resulting in local inflammation and accelerating endothelial damage and atherosclerosis.

In mouse monocytes, IL-19 is elevated in an acute systemic inflammatory state and promotes the generation of IL-6, TNF-α, and apoptosis. In addition, IL-19 upregulates TGF-β1 and MCP-1 expression in renal cortical collecting duct cells (M-1) and also activates caspase-3 and caspase-9 to promote cell apoptosis through the p38 MAPK pathway in M-1 cells [33], which can lead to interstitial fibrosis caused by excess extracellular matrix deposition. In M-1 cells, IL-19 can activate ERK 1/2, JNK, and p38 MAPK and inhibit p38 MAPK signaling, which reduces IL-19-induced apoptosis; these results suggest that IL-19 causes apoptosis in renal epithelial cells via these three pathways [34]. Moreover, Jennings et al. [35] revealed a substantial rise in IL-19 levels in the urine of patients with CKD, which is closely associated with calculated GFR levels, indicating that IL-19 was a possible novel translational marker of renal damage. Therefore, IL-19 or its receptor may represent novel therapeutic targets for addressing kidney impairment following DN.

The newly discovered pro-inflammatory cytokine, IL-34, has several functions in the modulation of inflammation and the immune response. Indeed, vascular diabetes complications may be predicted by serum IL-34 levels [36]. Moreover, multiple chronic inflammatory conditions can be caused by IL-34, and it has a significant role in the development of insulin resistance in T2DM patients [37]. In addition, IL-34 has been linked to impaired kidney function and severe anemia in patients with CKD [11]. Our study revealed upregulation of IL-34 expression in the patients with DN groups. In addition, IL-34 mRNA expression revealed a positive correlation with BMI, HbA1c, and creatinine and a negative correlation with GFR levels. Importantly, IL-34 stimulates the protein tyrosine phosphatase ζ receptor; during acute kidney damage, both receptors and cytokines are upregulated. Moreover, IL-34 increased both intrarenal macrophage and bone marrow cell proliferation, increasing the levels of circulating neutrophils and monocytes and their recruitment to the kidney [38]. It has been shown that TNF-α increased CSF-1 and IL-34 expression in intestinal epithelial cells via the NF-κB signaling pathway [39]. In mice, redacting IL-34 improves nephritis via macrophage- and autoantibody-mediated pathways both inside and outside the kidney. IL-34 is a possible therapeutic target for tubular epithelial cell damage, and IL-34 inhibition may have reno-protective effects [40]. Notably, IL-34 may be an effective biomarker and therapeutic target for treating inflammatory diseases, including DN.

IL-37 generates a complex with IL-18R and IL-1R8 that transduces anti-inflammatory signals by suppressing NF-κB and MAPK and activating the Mer-PTEN-DOK pathway. IL-37 exerts broad and complex anti-inflammatory and immunomodulatory effects, inhibits excess inflammation, and prevents tissue damage mediated by inflammation [41]. Importantly, IL-37 is a possible therapeutic target for managing obesity-induced insulin resistance and T2DM [42]. The biological effects of IL-37 can be attributed to its ability to inhibit NF-κB; the IL-6/STAT3 pathway; and TNF-α, IL-1β, and IL-6 synthesis [43]. In addition, it has been shown that a high IL-37 concentration is correlated with increased systemic lupus erythematous activity and impaired renal manifestations [44].

IL-37 mRNA expression was found to be decreased in the patients with diabetes and both kidney dysfunction groups relative to the healthy control group. In addition, IL-37 mRNA expression revealed a negative correlation with BMI, HbA1c, and creatinine and a positive correlation with GFR levels. Notably, IL-37 can greatly reduce podocyte inflammation, oxidative stress, and apoptosis caused by hyperglycemia and can also block the STAT3-CypA signaling pathway [45]. Moreover, IL-37 decreased the kidney expression of TNF-α, IL-6, and IL-1β and alleviated mononuclear cell infiltration and kidney damage in a mouse ischemia injury model. Thus, IL-37 may represent an effective approach for suppressing renal damage responses and promoting renal function after renal ischemic damage [13]. In addition, understanding the role of IL-19, IL-34, and IL-37 in the pathogenicity of DN has been deemed crucial in creating novel anti-inflammatory agents to prevent or delay the onset of DN.

Hyperglycemia and insulin resistance are responsible for the micro- and macrovascular complications of diabetes. The metabolic insult of hyperglycemia and podocyte insulin resistance is a major source of podocyte damage, leading to albuminuria and proteinuric glomerulopathies in early DN [46]. Importantly, IL-19, IL-34, and NF-κB expression levels and the levels of IL-6 in diabetic and DCKD patients were associated with insulin sensitivity and insulin resistance. The sustained rise in inflammatory cytokines, such as IL-19, IL-34, and NF-κB, as well as serum IL-6 levels, is involved in the progression of insulin resistance in diabetic and DCKD patients. In patients with diabetes, prolonged activation of pro-inflammatory and pro-fibrotic cell types causes excess extracellular matrix deposition [47]. These elements are involved in the stimulation and proliferation of smooth muscle actin-positive myofibroblasts, which are essential for the excessive synthesis of extracellular matrix, ultimately leading to DN [48]. Thus, IL-6, IL-19, IL-34, IL-37, and NF-κB may represent therapeutic targets for preventing or alleviating diabetic kidney disorders as well as their complications.

The current study has several limitations, including the small study population in the patient groups and the fact that the findings were separated depending on renal stages and disease duration. In addition, the lack of determination of IL-19, IL-34, and IL-37 at protein levels, immunohistochemistry staining slides for interleukin levels in the patients, and the addition of more inflammatory and anti-inflammatory cytokines could influence inflammation processes, pathogenesis, and DN development. Importantly, clinical investigations in larger cohorts are required to deeply understand the pathways that influence IL-19, IL-34, and IL-37 in the etiology and pathogenicity of DN.

5 Conclusion

Hyperglycemia, insulin resistance, and chronic inflammation are responsible for the development of diabetic complications, such as DN. The obtained results could indicate the potential implication of NF-κB, IL-19, IL-34, and IL-6 levels, along with the decrease in IL-37 expression and serum SOD activity, in the pathophysiology of kidney disease in diabetes. Thus, IL-6, IL-19, IL-34, IL-37, and NF-κB or their receptors may be a research target for the pathogenesis and therapies of DN.

Availability of data and materials

The datasets used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Abbreviations

CKD:

Chronic kidney disease

DN:

Diabetic nephropathy

DCKD:

Diabetic chronic kidney disease

GFR:

Glomerular filtration rate

HbA1c:

Glycosylated hemoglobin

HOMA-IR:

Homeostasis model assessment for insulin resistance

HOMA-IS:

Homeostasis model assessment for insulin sensitivity

HOMA-β:

Homeostasis model assessment for beta-cell function

IL:

Interleukin

NF-κB:

Nuclear factor kappa B

PCR:

Polymerase chain reaction

RT:

Real time

SOD:

Superoxide dismutase

T2DM:

Type 2 diabetes mellitus

References

  1. Abdel Aziz SM, Ahmed OM, Abd El-Twab SM, Al-Muzafar HM, Amin KA, Abdel-Gabbar M (2020) Antihyperglycemic effects and mode of actions of musa paradisiaca leaf and fruit peel hydroethanolic extracts in nicotinamide/streptozotocin-induced diabetic rats. Evid Based Complement Alternat Med 2020(2020):9276343

    PubMed  PubMed Central  Google Scholar 

  2. Mahmoud B, Abdel-Moneim A, Negeem Z, Nabil A (2022) The relationship between B-cell lymphoma 2, interleukin-1β, interleukin-17, and interleukin-33 and the development of diabetic nephropathy. Mol Biol Rep 49(5):3803–3809

    Article  CAS  PubMed  Google Scholar 

  3. Selby NM, Taal MW (2020) An updated overview of diabetic nephropathy: Diagnosis, prognosis, treatment goals and latest guidelines. Diabetes Obes Metab 22(1):3–15

    Article  PubMed  Google Scholar 

  4. Pérez-Morales RE, Del Pino MD, Valdivielso JM, Ortiz A, Mora-Fernández C, Navarro-González JF (2019) Inflammation in diabetic kidney disease. Nephron 143(1):12–16

    Article  PubMed  Google Scholar 

  5. Gómez-Chávez F, Correa D, Navarrete-Meneses P, Cancino-Diaz JC, Cancino-Diaz ME, Rodríguez-Martínez S (2021) NF-κB and its regulators during pregnancy. Front Immunol 12:679106

    Article  PubMed  PubMed Central  Google Scholar 

  6. Esposito K, Nappo F, Marfella R, Giugliano G, Giugliano F, Ciotola M, Quagliaro L, Ceriello A, Giugliano D (2002) Inflammatory cytokine concentrations are acutely increased by hyperglycemia in humans: role of oxidative stress. Circulation 106(16):2067–2072

    Article  CAS  PubMed  Google Scholar 

  7. Wang X, Tao L, Hai CX (2012) Redox-regulating role of insulin: the essence of insulin effect. Mol Cell Endocrinol 349(2):111–127

    Article  CAS  PubMed  Google Scholar 

  8. Albeladi FI, Mostafa MM, Zayed MA, Atta H (2022) Association of polymorphisms in antioxidant enzyme-encoding genes with diabetic nephropathy in a group of saudi arabian patients with type ii diabetes mellitus. Int J Gen Med 15:5919–5928

    Article  PubMed  PubMed Central  Google Scholar 

  9. Araújo LS, Torquato B, da Silva CA, Dos Reis MM, Dos Santos MA, da Silva MV, Dos Reis MA, Machado JR (2020) Renal expression of cytokines and chemokines in diabetic nephropathy. BMC Nephrol 21(1):308

    Article  PubMed  PubMed Central  Google Scholar 

  10. Li L, Jiang XG, Hu JY, Yu ZQ, Xu JY, Liu F, Zhao GC, Zhang L, Gu HM, Zhang SJ, Meng J (2017) The association between interleukin-19 concentration and diabetic nephropathy. BMC Nephrol 18(1):65

    Article  PubMed  PubMed Central  Google Scholar 

  11. Fan Q, Yan X, Zhang H, Lu L, Zhang Q, Wang F, Xi R, Hu J, Chen Q, Niu W, Shen W, Zhang R, Tao R (2016) IL-34 is associated with the presence and severity of renal dysfunction and coronary artery disease in patients with heart failure. Sci Rep 6:39324

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  12. Li T, Li H, Li W, Chen S-F, Feng T, Jiao W, Wu C, Dong J, Li Y, Li S, Feng M, Wei X (2019) Interleukin-37 sensitize the elderly type 2 diabetic patients to insulin therapy through suppressing the gut microbiota dysbiosis. Mol Immunol 112:322–329

    Article  CAS  PubMed  Google Scholar 

  13. Yang Y, Zhang ZX, Lian D, Haig A, Bhattacharjee RN, Jevnikar AM (2015) IL-37 inhibits IL-18-induced tubular epithelial cell expression of pro-inflammatory cytokines and renal ischemia-reperfusion injury. Kidney Int 87(2):396–408

    Article  CAS  PubMed  Google Scholar 

  14. Wallace TM, Levy JC, Matthews DR (2004) Use and abuse of HOMA modeling. Diabetes Care 27(6):1487–1495

    Article  PubMed  Google Scholar 

  15. Jeong TD, Lee W, Chun S, Ryu J-S, Min W-K (2010) Park JS (2013) Comparison of the MDRD study and CKD-EPI equations for the estimation of the glomerular filtration rate in the Korean general population: the fifth Korea National Health and Nutrition Examination Survey (KNHANES V-1). Kidney Blood Press Res 37(4–5):443–450

    Google Scholar 

  16. Erfanpoor S, Etemad K, Kazempour S, Hadaegh F, Hasani J, Azizi F, Parizadeh D, Khalili D (2021) Diabetes, hypertension, and incidence of chronic kidney disease: Is there any multiplicative or additive interaction? Int J Endocrinol Metab 19(1):e101061

    PubMed  Google Scholar 

  17. Andrade-Oliveira V, Foresto-Neto O, Watanabe IKM, Zatz R, Câmara NOS (2019) Inflammation in renal diseases: new and old players. Front Pharmacol 10:1192

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  18. Albert-Garay JS, Riesgo-Escovar JR, Salceda R (2022) High glucose concentrations induce oxidative stress by inhibiting Nrf2 expression in rat Müller retinal cells in vitro. Sci Rep 12(1):1261

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  19. Pautz A, Franzen R, Dorsch S, Böddinghaus B, Briner AV, Pfeilschifter J, Huwiler A (2002) Cross-talk between nitric oxide and superoxide determines ceramide formation and apoptosis in glomerular cells. Kidney Int 61:790–796

    Article  CAS  PubMed  Google Scholar 

  20. Liu D, Wu M, Li L, Gao X, Yang B, Mei S, Fu L, Mei C (2018) Low-protein diet supplemented with ketoacids delays the progression of diabetic nephropathy by inhibiting oxidative stress in the KKAy mice model. Br J Nutr 119(1):22–29

    Article  CAS  PubMed  Google Scholar 

  21. DeRubertis FR, Craven PA, Melhem MF, Salah EM (2004) Attenuation of renal injury in db/db mice overexpressing superoxide dismutase: evidence for reduced superoxide-nitric oxide interaction. Diabetes 53:762–768

    Article  CAS  PubMed  Google Scholar 

  22. Yu YY, Li XQ, Hu WP, Cu SC, Dai JJ, Gao YN, Zhang YT, Bai XY, Shi DY (2022) Self-developed NF-κB inhibitor 270 protects against LPS-induced acute kidney injury and lung injury through improving inflammation. Biomed Pharmacother 147:112615

    Article  CAS  PubMed  Google Scholar 

  23. Oliveira KC, Zambom FFF, Albino AH, Alarcon Arias SC, Ávila VF, Faustino VD, Malheiros DMAC, Camara NOS, Fujihara CK, Zatz R (2020) NF-κB blockade during short-term l-NAME and salt overload strongly attenuates the late development of chronic kidney disease. Am J Physiol Renal Physiol 319(2):F215–F228

    Article  CAS  PubMed  Google Scholar 

  24. Henke N, Schmidt-Ullrich R, Dechend R, Park J-K, Qadri F, Wellner M, Obst M, Gross V, Dietz R, Luft FC, Scheidereit C, Muller DN (2007) Vascular endothelial cell-specific NF-kappaB suppression attenuates hypertension-induced renal damage. Circ Res 101(3):268–276

    Article  CAS  PubMed  Google Scholar 

  25. Nejatbakhsh Samimi L, Farhadi E, Tahmasebi MN, Jamshidi A, Vaziri A, Mahmoudi M (2020) NF-κB signaling in rheumatoid arthritis with focus on fibroblast-like synoviocytes. Autoimmun Highlights 11:11

    Article  CAS  Google Scholar 

  26. Rehman K, Akash MSH, Liaqat A, Kamal S, Qadir MI, Rasul A (2017) Role of interleukin-6 in development of insulin resistance and type 2 diabetes mellitus. Crit Rev Eukaryot Gene Expr 27(3):229–236

    Article  PubMed  Google Scholar 

  27. Rapa SF, Di Iorio BR, Campiglia P, Heidland A, Marzocco S (2020) Inflammation and oxidative stress in chronic kidney disease-potential therapeutic role of minerals, vitamins and plant-derived metabolites. Int J Mol Sci 21(1):263

    Article  CAS  Google Scholar 

  28. Su H, Lei CT, Zhang C (2017) Interleukin-6 signaling pathway and its role in kidney disease: an update. Front Immunol 8:405

    Article  PubMed  PubMed Central  Google Scholar 

  29. Kim DI, Park SH (2013) Sequential signaling cascade of IL-6 and PGC-1alpha is involved in high glucose-induced podocyte loss and growth arrest. Biochem Biophys Res Commun 435:702–707

    Article  CAS  PubMed  Google Scholar 

  30. Cuneo AA, Herrick D, Autieri MV (2010) IL-19 reduces VSMC activation by regulation of mRNA regulatory factor HuR and reduction of mRNA stability. J Mol Cell Cardiol 49:647–654

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Li L, Yu ZH, Qian L, Xu J-Y, Liu F, Zhao G-C, Zhang L, Gu H-M, Zhang S-Z, Meng J (2016) Interleukin-19 and angiopoietin-2 can enhance angiogenesis of diabetic complications. J Diabetes Complicat 30(2):386–387

    Article  Google Scholar 

  32. Atiia MA, Hafez YM, Mabrouk MM, Ghazy MA (2021) Assessment of serum interleukin-19 level in patients with diabetic nephropathy. J Adv Med Med Res 33(19):15–25

    Article  Google Scholar 

  33. Hsu Y-H, Li H-H, Sung J-M, Chen W-T, Hou Y-C, Chang M-S (2013) Interleukin-19 mediates tissue damage in murine ischemic acute kidney injury. PLoS ONE 8:e56028

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  34. Hsu YH, Li HH, Sung JM, Chen WT, Hou YC, Chang MS (2013) Interleukin-19 mediates tissue damage in murine ischemic acute kidney injury. PLoS ONE 8(2):e56028

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  35. Jennings P, Crean D, Aschauer L, Limonciel A, Moenks K, Kern G, Hewitt P, Lhotta K, Lukas A, Wilmes A, Leonard MO (2015) Interleukin-19 as a translational indicator of renal injury. Arch Toxicol 89:101–106

    Article  CAS  PubMed  Google Scholar 

  36. Below JE, Gamazon ER, Morrison JV, Konkashbaev A, Pluzhnikov A, McKeigue PM, Parra EJ, Elbein SC, Hallman DM, Nicolae DL, Bell GI, Cruz M, Cox NJ, Hanis CL (2011) Genome-wide association and meta-analysis in populations from Starr County, Texas, and Mexico City identify type 2 diabetes susceptibility loci and enrichment for expression quantitative trait loci in top signals. Diabetologia 54:2047–2055

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Mostafa TM, El-Gharbawy NM, Werida RH (2021) Circulating IRAPe, irisin, and IL-34 in relation to insulin resistance in patients with type 2 diabetes. Clin Ther S0149–2918(21):00218–00226

    Google Scholar 

  38. Sanchez-Niño MD, Sanz AB, Ortiz A (2016) Chronicity following ischaemia-reperfusion injury depends on tubular-macrophage crosstalk involving two tubular cell-derived CSF-1R activators: CSF-1 and IL-34. Nephrol Dial Transpl 31(9):1409–1416

    Article  Google Scholar 

  39. Zwicker S, Martinez GL, Bosma M, Gerling M, Clark R, Majster M, Söderman J, Almer S, Boström EA (2015) Interleukin 34: a new modulator of human and experimental inflammatory bowel disease. Clin Sci (Lond) 129:281–290

    Article  CAS  Google Scholar 

  40. Wada Y, Iyoda M, Matsumoto K, Suzuki T, Tachibana S, Kanazawa N, Honda H (2021) Reno-protective effect of IL-34 inhibition on cisplatin-induced nephrotoxicity in mice. PLoS ONE 16(1):e0245340

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  41. Su Z, Tao X (2021) Current understanding of IL-37 in human health and disease. Front Immunol 12:696605

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  42. Ballak DB, Li S, Cavalli G, Stahl JL, Tengesdal IW, van Diepen JA, Klück V, Swartzwelter B, Azam T, Tack CJ, Stienstra R, Mandrup-Poulsen T, Seals DR, Dinarello CA (2018) Interleukin-37 treatment of mice with metabolic syndrome improves insulin sensitivity and reduces pro-inflammatory cytokine production in adipose tissue. J Biol Chem 293(37):14224–14236

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  43. Wang L, Liu Z, Huang D, Ran Y, Zhang H, He J, Yin N, Qi H (2020) IL-37 exerts anti-inflammatory effects in fetal membranes of spontaneous preterm birth via the NF-κB and IL-6/STAT3 signaling pathway. Mediators Inflamm 2020:1069563

    Article  PubMed  PubMed Central  Google Scholar 

  44. Tawfik MG, Nasef SI, Omar HH, Ghaly MS (2017) Serum interleukin-37: a new player in lupus nephritis? Int J Rheum Dis 20(8):996–1001

    Article  CAS  PubMed  Google Scholar 

  45. Zhang X, Zhu Y, Zhou Y, Fei B (2020) Interleukin 37 (IL-37) reduces high glucose-induced inflammation, oxidative stress, and apoptosis of podocytes by inhibiting the STAT3-cyclophilin A (CypA) signaling pathway. Med Sci Monit 26:e922979

    CAS  PubMed  PubMed Central  Google Scholar 

  46. Barutta F, Bellini S, Gruden G (2022) Mechanisms of podocyte injury and implications for diabetic nephropathy. Clin Sci (Lond) 136(7):493–520

    Article  Google Scholar 

  47. Black LM, Lever JM, Agarwal A (2019) Renal Inflammation and fibrosis: a double-edged sword. J Histochem Cytochem 67(9):663–681

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  48. Yuan Q, Tan RJ, Liu Y (2019) Myofibroblast in kidney fibrosis: origin, activation, and regulation. Adv Exp Med Biol 1165:253–283

    Article  CAS  PubMed  Google Scholar 

Download references

Funding

The study did not receive any funding.

Author information

Authors and Affiliations

  1. Biochemistry Department, Faculty of Science, Beni-Suef University, Beni-Suef, Egypt

    Doaa Esam, Basant Mahmoud & Mohamed Abdel-Gabbar

  2. Molecular Physiology Division, Faculty of Science, Beni-Suef University, Salah Salim St., Beni-Suef, 62511, Egypt

    Adel Abdel-Moneim

Authors
  1. Doaa Esam
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Adel Abdel-Moneim
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Basant Mahmoud
    View author publications

    You can also search for this author in PubMed Google Scholar

  4. Mohamed Abdel-Gabbar
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

All authors contributed to the study’s conception and design. Data collection, material preparation, and analysis were performed by BM, DE, and MAG. The draft of the article was written by BM, AAM, and MAG. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Adel Abdel-Moneim.

Ethics declarations

Ethics approval and consent to participate

Written informed consent was given by all participants, and the research protocol was approved by the Kidney Hospital, Beni-Suef, Egypt, ethical committee in compliance with the Declaration of Helsinki and the recommendations for good clinical practice (BSU/2018/7).

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Additional information

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Esam, D., Abdel-Moneim, A., Mahmoud, B. et al. Role of nuclear factor kappa B, interleukin-19, interleukin-34, and interleukin-37 expression in diabetic nephropathy. Beni-Suef Univ J Basic Appl Sci 11, 119 (2022). https://doi.org/10.1186/s43088-022-00299-9

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s43088-022-00299-9

Keywords